Class 12 Biology Model Paper 3 MCQs Test

1. An mRNA codon for the amino acid alanine is GCC. How many alanine molecules are present in the polypeptide, containing 8 amino acids coded for by the following DNA template?
TCGGCCTACCGGGCCCATGCCAAT

2. When the outer air temperature is higher than body temperature, which of the following combination of control mechanisms is the most likely to occur?

3. Which row in the following table correctly describes what happens in the body after a person consumes a glass of sugary drink?

4. The hamstring muscles are present:

5. The honey bees can communicate the distance to the food source by:
1- speed of the dance
2- length of buzzing while dancing
3- a straight run

6. Following is the gel pattern taken from Sangar‘s method of DNA sequencing. Read the sequence given in the gel:

7. Maintaining a resting membrane potential across the membrane required energy from ATP. In which of the following event, the ATPs are hydrolyzed?

8. During birth following events happen:
1- Rupturing of amniotic sac
2- Contraction of myometrium
3- Cutting of umbilical cord
4- Inhibition of progesterone secretion
Which one of the following is the correct sequence of these events from start to
end?

9. Five different amino acids (number 1-5 below) from the following sequence is
part of a polypeptide chain:
1 — 2 — 3 — 4 — 2 — 5 — 3
and mRNA codons which corresponds to these amino acids are:
1=UGU, 2=GAU, 3=CAC, 4=UAG, 5=AAG.
Which one of the following DNA base sequences could provide the code for the
give section of polypeptide?

10. The diagram given below represents some of the muscles involved with breathing.

11. Students were discussing how to remember the difference between two group of cells, ―many, minute and motile‖ or ―few, large and non-motile‖. Which of the following group of cells were they referring to?

12. Which one of the following stage of sewage treatment consists of temporarily holding the sewage in a quiescent basin where heavy solids can settle to the bottom while oil, grease and lighter solids float to the surface?

13. The image below shows a cell from the nervous system. The cell is the part of a reflex arc.

14. When populations of a species that share the same habitat become reproductively isolated from each other and evolve into different species after many generations. Such origin of new species is called:

15. The graph shows the relationship between the number of lichens and the levels of sulfur dioxide pollution. It indicates that as the sulfur dioxide levels increase, the number of lichen decreases:

16. Albinism is a recessive trait. A normal woman with albino father and normal mother marries an albino man. What is the probability of albinism in her children?

17. If one pair of alleles exhibits complete dominance while the other pair exhibits incomplete dominance, what will be the outcome in F1 generation of a cross between AABB (Male) X aabb (female) parents?